RNA Secondary Structure Visualization Using a Force Directed Graph Layout

Overview

The forna package provides a web interface for displaying RNA secondary structures using the force-directed graph layout provided by the d3.js visualization library.

The front end makes use of Bootstrap and Knockout.js for the user interfact while the back end uses Flask to serve the static files and provide a REST API. The RNA structure manipulation and graph construction is created using the python forgi RNA structure manipulation library and the provided forna.py script. We heavily depend on the python bindings of the ViennaRNA package.

Usage

Click on Add Molecule to draw a new secondary structure. The input should contain a sequence and a secondary structure in dot-bracket notation:

GCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((((..((((((.........))))))......).((((((.......))))))..)))))))))

You can also use the FASTA format to add multiple molecule at once. If you do not enter a structure, it will calculate the MFE structure at 37°C for you.

Zooming can be accomplished using the mouse wheel. Dragging the canvas leads to panning.

Circular RNA

Circular RNA molecules can be specified by adding an asterisk(*) to the end of the structure. This simply adds a link between the first and last nucleotides. Example:

>x
ACCCAAACAAAAAAAAAAAAAA
...((...))..((..))...*

Colors

Position

Color the nucleotides according to their position in the molecule. Lower numbered nucleotides are closer to the 5' end and are colored green. Nucleotides in the middle are colored yellow whereas nucleotides near the 3' end are colored red.

Structure

Color the nucleotides according to the type of structure that they are in:

Green: Stems (canonical helices) Red: Multiloops (junctions) Yellow: Interior Loops Blue: Hairpin loops Orange: 5' unpaired region Light Blue: 3' unpaired region

Sequence

Color according to the nucleotide types:

Yellow: Adenine Green: Cytosine Blue: Uridine Red: Guanine

Runing Locally

The server can be run locally on your machine. It depends on the forgi library and needs the ViennaRNA package installed with python bindings enabled. Further, you need to downlaod the MC-Annotate program and make it executeable by the server script. To run it use the following command:

python forna_server.py -s -d

Documentation about the available options is provided using the -h option.

APIs

We provide the opportunity to add an RNA molecule from supported platforms using URL encoded queries. At the moment the ViennaRNA webservices and the RNAcentral database are supported as well as URL encoded data. Please contact us if you have suggestions for additional platforms.

To add a molecule using the RNAcentral-ID you can just call forna like this: forna-domain/?id=RNAcentral/RNAcentral-ID eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=RNAcentral/URS0000000001

To include the data directly in the URL, two formats are available: forna-domain/?id=fasta&file=fasta-file eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=fasta&file=>header\nAACGUUAGUU\n(((....))) forna-domain/?id=url/molecule-name&sequence=sequence&structure=structure eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=url/name&sequence=AACGUUAGUU&structure=(((....))) In the first case it's possible to input multiple molecules at once by having them all in a single string which is passed to the 'file' query. Note that in both cases the structure is optional. If it's not provided, RNAfold will calculate and display the MFE structure.

For any platform it is also optionally possible to append a colors query using the custom color format: forna-domain/?id=fasta&file=fasta-file&colors=custom-color-format eg: http://nibiru.tbi.univie.ac.at/forna/forna.html?id=fasta&file=>header\nAACGUUAGUU\n(((....)))&colors=>header\n0\n0.1\n0.2\n0.3\n0.4\n0.5\n0.6\n0.7\n0.8\n0.9\n1

This way it's also possible to embed forna on a website with a preloaded molecule.

<iframe src="forna/index.html?id=RNAcentral/URS0000000001" align="center" height="650px" width="100%" 
seamless='seamless' frameBorder="0" AllowFullScreen></iframe>

Contact

Questions and/or comments can be sent to [email protected]

Acknowledgement

This project is, among others, supported by the European Commission under the Environment Theme of the 7th Framework Program for Research and Technological Development (Grant agreement no: 323987).