Command line interface (CLI) and Python 3 client library for interacting with the CosmosID-HUB API. Only works with Python [3.6,3.7,3.8,3.9,3.10].
- python3
- python3-pip
- poetry
This package provides:
- core Python 3 client library;
- a simple CLI for interacting with the CosmosID-HUB API;
The CLI with the core Python library can be installed using pip3
.
- simply run from console
sudo pip3 install cosmosid_cli
Note: pip3 and setuptools should be upgraded to latest version. Please update those packages on you workstation regarding to your OS update process before setup CosmosID-HUB CLI.
E.g. for Ubuntu 14.04 perform following steps: $ sudo apt-get update $ sudo apt-get upgrade $ sudo -H pip3 install -U pip setuptools
If you had have previously installed CosmosID-HUB CLI just upgrade CLI to latest version.
$ sudo -H pip3 install --upgrade cosmosid_cli
To install package locally from folder with source files do the following:
- install
poetry
check the doc cd cosmosid-cli/package/
poetry install
Assure that you have Conda already installed or install it based on your system requirements - link
Follow the cosmosid project page to check the last version of cosmosid-cli available on Anaconda.org
The CLI with Conda can be installed by the following command:
conda install -c cosmosid -c conda-forge cosmosid-cli
Verify the CLI version installed
cosmosid --version
The CosmosID-HUB CLI supports authentication via CosmosID-HUB API Key.
Your API key can be found on the CosmosID-HUB profile page.
To automatically authenticate via CosmosID-HUB API Key you should create
credential file ~/.cosmosid
and store your API Key into it in
the following format:
{
"api_key": "<your api key string>"
}
You can directly use your CosmosID-HUB API Key, rather than storing it in a credential file. To use API Key authentication,
pass your key as an argument to the cosmosid
command:
cosmosid --api_key=YOUR_API_KEY <command>
CLI supports files of following extensions: 'fasta', 'fna', 'fasta.gz', 'fastq', 'fq', 'fastq.gz', 'bam', 'sra'
There are several types of commands supported by the CosmosID-HUB CLI
- Commands for retrieving data to terminal (output) from CosmosID cloud - files, runs, analysis.
- Commands for uploading metagenomics or amplicon samples to CosmosID cloud for analysis - uploads.
- Commands for retrieving the reports archive from CosmosID cloud - reports
Note: Each command has options. To get usage information for each CosmosID-HUB CLI command, the user can simply run
cosmosid <command> --help
The command to make a new directory or sub-directory. See --help for options:
usage: cosmosid mkdir [-h] [--parent PARENT] [--name NAME]
Make a new directory in a given directory.
options:
-h, --help show this help message and exit
--parent PARENT, -p PARENT
ID of the parent directory. Default: Root
--name NAME, -n NAME
Name of the new directory
Example to create a New
in some parent (41dad2d0-dcf2-429c-8e06-1ebea192985d
):
cosmosid --api_key=your-key mkdir -n New -p 41dad2d0-dcf2-429c-8e06-1ebea192985d
The commands for retrieving data have options for output format. The user can get data into the terminal (or another output) in a different format - csv, json, table, value, yaml (table is default), and specify the column(s) to show. In additional there are CSV format options, user can quote or unquote or partly quote output values - all, minimal, none, non-numeric (by default only non-numeric values are quoted)
Example of output for the --help options for the command:
$ cosmosid files --help
usage: cosmosid files [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN]
[--noindent] [--max-width <integer>] [--fit-width]
[--print-empty] [--quote {all,minimal,none,nonnumeric}]
[--parent PARENT]
[--order {type,name,id,status,size,created}] [--up]
Show files in a given directory.
optional arguments:
-h, --help show this help message and exit
--parent PARENT, -p PARENT
ID of the parent directory. Default: Root
--order {type,name,id,status,reads,created}, -o {type,name,id,status,size,created}
field for ordering
--up order direction
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, 1 to disable. You can also use
the CLIFF_MAX_TERM_WIDTH environment variable, but the
parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-
width greater than 0. Set the environment variable
CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
CSV Formatter:
--quote {all,minimal,none,nonnumeric} when to include quotes, defaults to nonnumeric
To retrieve files (samples) stored in CosmosID simply run the cosmosid
command with a files
subcommand. For example:
#to get contents of your CosmosID root folder
cosmosid files
#to get contents of appropriate folder use its id as argument
cosmosid files --parent=<folder_id>
#to get ordered list simply use the ordering argument with field name with/without order direction
cosmosid files --parent=<folder_id> --order size --up
An each file (sample) stored in CosmosID has one or more Sample Run(s) associated with it.
Example of output for the --help options for the command:
$ cosmosid runs --help
usage: cosmosid runs [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent] [--max-width <integer>]
[--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending] --id ID [--order {id,status,created}] [--up]
Show List Of Runs for a given File.
optional arguments:
-h, --help show this help message and exit
--id ID, -i ID
ID of the sample
--order {id,status,created}, -o {id,status,created}
field for ordering
--up order direction
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
For example:
To retrieve sample run(s) associated with a file simply run the cosmosid
command with runs
subcommand.
#to get runs associated with a speciffic file (sample)
cosmosid runs --id=<file_id>
#command output:
Runs list for file example_2.fastq.gz (id: 5020a209-30b8-4fb3-bd78-b9fa1cd9f3ae)
+--------------------------------------+---------------------+---------------+------------------+---------+--------------------------------------+
| id | created | workflow_name | workflow_version | status | artifact_types |
+--------------------------------------+---------------------+---------------+------------------+---------+--------------------------------------+
| a3dfe717-15d0-5053-a5b7-5c24597b73b4 | 2022-05-16 17:41:13 | ura | 1.0.0 | Success | ura |
| d722bfcb-a3e7-4617-9141-20f5168e8c2f | 2022-05-16 17:40:15 | amr_vir | 1.0.0 | Success | functional-pathway,functional-goterm |
+--------------------------------------+---------------------+---------------+------------------+---------+--------------------------------------+
The CosmosID-HUB CLI supports uploading sample files into CosmosID for analysis. CosmosID supports the following file formats and extension names: .fasta, .fna, .fasta.gz, .fastq, .fq, .fastq.gz, bam, bam.gz, sra, sra.gz. (SRA files can be uploaded without extension)
CosmosID supports the following types of analysis:
- Metagenomics
- Amplicon - 16S or ITS (only 16S and ITS supported for now)
Note: you can get usage help for each command and arguments of CosmosID-HUB CLI by simply runnig
cosmosid --help
orcosmosid <command> --help
# cosmosid upload --help
usage: cosmosid upload [-h] [--file FILE] [--parent PARENT] --type {metagenomics,amplicon-16s,amplicon-its}
[-wf WORKFLOW] [--forward-primer FORWARD_PRIMER] [--reverse-primer REVERSE_PRIMER]
[--amplicon-preset {v1_v3,v3_v4,v4}]
[--host-name {human:2.0.0,human:1.0.0,dog:2.0.0,domestic_cat:2.0.0,cow:1.0.0,chicken:2.0.0,mouse:2.0.0,monkey:2.0.0,cattle:2.0.0,pig:2.0.0}]
[--dir DIR]
Upload files to cosmosid.
optional arguments:
-h, --help show this help message and exit
--file FILE, -f FILE
file(s) for upload. Supported file types: fasta, fna, fasta.gz, fastq, fq, fastq.gz, bam, sra e.g. cosmosid upload
-f /path/file1.fasta -f /path/file2.fn
--parent PARENT, -p PARENT
cosmosid parent folder ID for upload
--type {metagenomics,amplicon-16s,amplicon-its}, -t {metagenomics,amplicon-16s,amplicon-its}
Type of analysis for a file
-wf WORKFLOW, --workflow WORKFLOW
To specify multiple workflows, define them coma separated without any additional symbols.For example:
-wf amr_vir,taxa
To specify workflow verions, define it by ':'. For example:
-wf taxa:1.1.0,amr_vir
--forward-primer FORWARD_PRIMER
Only for 'ampliseq' workflow
--reverse-primer REVERSE_PRIMER
Only for 'ampliseq' workflow
--amplicon-preset {v1_v3,v3_v4,v4}
Only for 'ampliseq' workflowv1_v3:
- forward_primer: AGAGTTTGATCCTGGCTCAG
- reverse_primer: ATTACCGCGGCTGCTGG
v3_v4:
- forward_primer: CCTACGGGRSGCAGCA
- reverse_primer: GACTACHVGGGTATCTAATCC
v4:
- forward_primer: GTGYCAGCMGCCGCGGTAA
- reverse_primer: GGACTACHVGGGTWTCTAAT
--host-name {human:2.0.0,human:1.0.0,dog:2.0.0,domestic_cat:2.0.0,cow:1.0.0,chicken:2.0.0,mouse:2.0.0,monkey:2.0.0,cattle:2.0.0,pig:2.0.0}
Name for host removal.
*Available only for type `metagenomics`
human:2.0.0 - Human 2.0.0 (GCF_009914755.1_T2T-CHM13v2.0)
human:1.0.0 - Human 1.0.0 (GRCh38_p6)
dog:2.0.0 - Dog (GCF_014441545.1_ROS_Cfam_1.0)
domestic_cat:2.0.0 - Domestic Cat (GCF_018350175.1_F.catus_Fca126_mat1.0)
cow:1.0.0 - Cow (GCF_002263795l_1_ARS-UCD1_2)
chicken:2.0.0 - Chicken (GCF_016699485.2_bGalGal1.mat.broiler.GRCg7b)
mouse:2.0.0 - Mouse (GCF_000001635.27_GRCm39)
monkey:2.0.0 - Monkey (GCF_003339765.1_Mmul_10)
cattle:2.0.0 - Cattle (GCF002263795.2 - ARS-UCD1.3)
pig:2.0.0 - Pig (GCF_000003025.6_Sscrofa11.1)
--dir DIR, -d DIR
directory with files for upload e.g. cosmosid upload -d /path/my_dir
To upload sample file to CosmosID run cosmosid
command with upload
subcommand. By default samples will be uploaded
into root folder. To upload sample into specific existing folder you must use id of the folder as parameter.
The CosmosID-HUB CLI supports uploading multiple Single-Read and Paired-End samples. For Paired-End samples, the CLI
automatically parse and merge samples in pairs if the samples follow the naming conventions like: xxx_R1.fastq and
xxx_R2.fastq OR xxx_R1_001.fastq and xxx_R2_001.fastq. Note: Paired-End samples require "fastq" format
To upload all samples from folder run cosmosid upload
command with path to folder specified by --dir/-d parameter
Note: This command respects Paired-End samples grouping with the same rules as for regular upload
Note: The default workflow is
taxa
, that is not allowed for amplicon samples, and should be overriden by--workflow
argument.
Note: _You can view all possible workflows by
workflow
command
Running example:
cosmosid upload --type metagenomics -f /pathtofile/test1_R1.fastq
-f /pathtofile/test1_R2.fastq -f
/pathtofile/test2.fasta
#to upload one sample file for Metagenomics analysis
cosmosid upload --file <path to file> --type metagenomics
#to upload sample file into specific folder for Amplicon 16s analysis
cosmosid upload --file <path to file-1> --parent <folder id> --type amplicon-16s
#to upload all files from folder
cosmosid upload -d /home/user/samples/ --type metagenomics
#to upload with host-removal
cosmosid upload --file <path to file> --type metagenomics --host-name <host name>
#to upload ampliseq-batch
cosmosid upload --file <path to file> --type amplicon-16s --workflow ampliseq --amplicon-preset <preset>
cosmosid upload --file <path to file> --type amplicon-16s --workflow ampliseq --forward-primer <forward primer> --reverse-primer <reverse primer>
Note: uploading of a big file takes time, please be patient Available host names: human:2.0.0, human:1.0.0, dog:2.0.0, domestic_cat:2.0.0, cow:1.0.0, chicken:2.0.0, mouse:2.0.0, monkey:2.0.0, cattle:2.0.0, pig:2.0.0
Once file has been uploaded to CosmosID the analyzing process will automatically begin. You can check the status of metagenomics analysis on the page CosmosID Samples. Amplicon analysis results available only from CosmosID-HUB CLI for now.
To view workflows, that can be used for upload
command, you can use workflows
command:
cosmosid workflows
Result:
Using base URL: https://app.cosmosid.com
+---------------+---------+----------------------------+---------------------------------------------------------------------------------------------------------------+
| Name | Version | Sample Type | Description |
+---------------+---------+----------------------------+---------------------------------------------------------------------------------------------------------------+
| amplicon_its | 1.0.0 | Amplicon ITS | Amplicon ITS workflow allows you to characterize the fungi in a microbial community based on ITS |
| | | | (internal transcribed spacer) region with a genus to species taxonomic resolution of fungi. |
| ampliseq | 1.0.0 | Amplicon 16S | Amplicon 16S workflow allows you to characterize the bacteria in a microbial community based on 16S |
| | | | rRNA marker gene with a genus to species taxonomic resolution of bacteria. |
| | | | |
| | | | Please be advised, we recommend running Amplicon 16S workflow with a batch of sequencing data that has |
| | | | been generated from the same sequencing run. Running the Amplicon 16S workflow in a group of samples |
| | | | from the same sequencing run allows for more accurate error correction and denoising because it takes |
| | | | advantage of the technical variability present within the sequencing run. This variability can be used |
| | | | to identify and correct errors that are specific to the sequencing run, rather than errors that are |
| | | | specific to individual samples. That's why running Amplicon 16S with only 1 sample may not yield |
| | | | successful results. |
| amr_vir | 1.0.0 | Shotgun metagenomics (WGS) | The AMR and Virulence Marker workflow allows you to characterize the antimicrobial and virulence genes |
| | | | in the microbiome community. |
| amr_vir | 1.1.0 | Shotgun metagenomics (WGS) | None |
| bacteria_beta | 1.0.0 | Shotgun metagenomics (WGS) | The Bacteria Beta 2.1.0 workflow allows you to characterize the composition of the bacterial community |
| | | | in your sample with our new Bacterial Beta Database 2.1.0. |
| functional | 1.0.0 | Shotgun metagenomics (WGS) | The Functional workflow allows you to leverage the power of the MetaCyc Pathway and Gene Ontology |
| | | | databases to characterize and predict the functional potential of the underlying microbiome community. |
| | | | |
| | | | If you are planning to run Functional 1.0 workflow for your data, please consider running Functional |
| | | | 2.0 since Functional 1.0 will be phased out and will be unavailable on the HUB in 6 months time. |
| kepler | 1.0.0 | Shotgun metagenomics (WGS) | We are delighted to present the newest edition of our Taxa Workflow, "Taxa-Kepler". The taxa |
| | | | workflow has been upgraded to effectively merge the sensitivity and precision of our k-mer methodology |
| | | | with our novel Probabilistic Smith-Waterman read-alignment approach. The resulting integration not only |
| | | | augments the ability to estimate taxa abundance but also enhances the classification accuracy and |
| | | | precision. Experience accurate microbiome community characterization with "Taxa-Kepler" |
| kepler | 1.1.0 | Shotgun metagenomics (WGS) | None |
| kepler_domain | 1.1.0 | Shotgun metagenomics (WGS) | None |
| taxa | 1.1.0 | Shotgun metagenomics (WGS) | The Taxa workflow allows you to leverage the power of the CosmosID taxonomic databases to characterize |
| | | | the microbiome community with strain level resolution across multiple kingdoms. |
| taxa | 1.2.0 | Shotgun metagenomics (WGS) | The Taxa workflow allows you to leverage the power of the CosmosID taxonomic databases to characterize |
| | | | the microbiome community with strain level resolution across multiple kingdoms. |
+---------------+---------+----------------------------+---------------------------------------------------------------------------------------------------------------+
Analysis results can be retrieved from CosmosID by useing run id or file id. The latest run analysis results will be
retrieved when file id used.
To retrieve analysis results for a specified run in CosmosID simply run cosmosid
command with analysis
subcommand.
$ cosmosid analysis --help
usage: cosmosid analysis [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent] [--max-width <integer>]
[--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending] [--id ID] [--run_id RUN_ID]
[--order {database,id,strains,strains_filtered,status}] [--up]
Show Analysis for a given file.
optional arguments:
-h, --help show this help message and exit
--id ID, -i ID
ID of a file
--run_id RUN_ID, -r RUN_ID
ID of a sample run
--order {database,id,strains,strains_filtered,status}, -o {database,id,strains,strains_filtered,status}
field for ordering
--up order direction
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
For example:
#to get list of analysis for the latest run of file
cosmosid analysis --id=<file ID>
#to get list of analysis for a given run id
cosmosid analysis --run_id=<run ID>
#to get ordered list of analysis for a given file id simply use ordering argument with field name with/without order direction
cosmosid analysis --id=<file ID> --order created --up
Note: There is no analysis results for Amplicon 16S and Amplicon ITS sample. Use report generation instead of getting list of analysis for Amplicon 16S and Amplicon ITS.
The CosmosID-HUB CLI supports retrieving the archive of analysis reports from CosmosID for a given File ID
with a
given Run ID
and saving the archive to a given file.
To retrieve an analysis report archive with TSV files run the cosmosid
command with reports
subcommand.
$ cosmosid reports --help
usage: cosmosid reports [-h] --id ID [--timeout TIMEOUT]
[--output OUTPUT | --dir DIR]
Get analysis reports TSV
optional arguments:
-h, --help show this help message and exit
--id ID, -i ID
ID of cosmosid sample.
--timeout TIMEOUT, -t TIMEOUT
The timeout in seconds. Default: 5 minutes.
--output OUTPUT, -o OUTPUT
output file name. Must have .zip extension. Default: is equivalent to cosmosid file name.
--dir DIR, -d DIR
Output directory for a file. Default: is current directory.
For example:
# to create analysis report archive for the latest run of sample and save it in
# a current directory with a name equivalent to file name in CosmosID
cosmosid reports --id=<file ID>
# to create analysis report archive for the given run of sample and save it in
# a current directory with a name equivalent to file name in CosmosID
cosmosid reports --id=<file ID> --run_id=<run ID>
# to create analysis report archive for the given run of sample and save it
# in a given directory
cosmosid reports --id=<file ID> --run_id=<run ID> --dir ~/cosmosid/reports
# to create analysis report archive for the given run of sample and save it
# into a given local file
cosmosid reports --id=<file ID> --output /tmp/analysis_report.zip
Artifacts results can be retrieved from CosmosID by using run id.
To retrieve artifacts results for a specified run in CosmosID simply run cosmosid
command with artifacts
subcommand.
$ cosmosid artifacts --help
usage: cosmosid artifacts [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent] [--max-width <integer>]
[--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending] --run_id RUN_ID [--type {fastqc-zip}]
[--url] [--output OUTPUT] [--dir DIR]
Show Artifacts for a given file.
optional arguments:
-h, --help show this help message and exit
--run_id RUN_ID, -r RUN_ID
ID of a sample run
--type {fastqc-zip}, -t {fastqc-zip}
Artifact type to download
--url show download url
--output OUTPUT, -o OUTPUT
output file name. Must have .zip extension. Default: is equivalent to cosmosid file name.
--dir DIR, -d DIR
Output directory for a file. Default: is current directory.
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
For example:
#to get list of artifacts for a given run id
cosmosid artifacts --run_id=<run ID>
##to create artifacts archive for the given run id of sample and store it to given path
cosmosid artifacts --run_id=<run ID> --type=fastqc-zip --dir /home/user
##to create artifacts archive for the given run id of sample and store it with given name in current dir
cosmosid artifacts --run_id=<run ID> --type=fastqc-zip --output artifacts_report.zip
##to create artifacts archive for the given run id of sample and store it with given name and given dir
cosmosid artifacts --run_id=<run ID> --type=fastqc-zip --dir /home/user --output artifacts_report.zip
#to get url to download the archive
cosmosid artifacts --run_id=<run ID> --type=fastqc-zip --url
Original samples can be downloaded from CosmosID by using samples_ids.
To download samples for a specified samples_id in CosmosID simply run cosmosids
command with download
subcommand.
Note: We recommend installing pycurl for the best experience with a sample download, see: http://pycurl.io/docs/latest/index.html#installation
$ cosmosid download --help
usage: cosmosid download [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent] [--max-width <integer>]
[--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending] [--samples_ids SAMPLES_IDS]
[--input-file INPUT_FILE] [--dir DIR] [--no-display] [--concurrent-downloads CONCURRENT_DOWNLOADS]
Download Samples for a given samples ids.
optional arguments:
-h, --help show this help message and exit
--samples_ids SAMPLES_IDS, -s SAMPLES_IDS
Comma separated list of samples uuids
--input-file INPUT_FILE
Path to file with samples' ids
--dir DIR, -d DIR
Output directory for a file. Default: is current directory.
--no-display Disable displaying loading process
--concurrent-downloads CONCURRENT_DOWNLOADS
Limit concurrent files downloads
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
For example:
#to download the original samples and save them in the current dir
cosmosid download --samples_ids=<sample_id>
#to download the originals samples and save them in the current dir
cosmosid download --samples_ids=<sample_id>,<sample_id> #separated by comma ","
#to download the originals samples and store them in the given path
cosmosid download --samples_ids=<sample_id>,<sample_id> --dir=<path_to_directory>
#to download the originals samples without displaying download progress
cosmosid download --samples_ids=<samples_id>,<sample_id> --no-display
#to download the original samples with specified quantity of concurrent files downloads
cosmosid download --samples_ids=<sample_id>,<sample_id> --concurrent-downloads=<quantity>
#to download the original samples using file with their ids
cosmosid download --input-file=<path-to-file>
Note: You can specify chunk size by CHUNK_SIZE environment variable
It's possible to view list of comparative analyses and download them.
#print list of comparatives generated using metadata & cohorts menu
cosmosid comparatives --help
usage: cosmosid comparatives [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent] [--max-width <integer>]
[--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending]
List of comparatives
optional arguments:
-h, --help show this help message and exit
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
Print list of comparatives generated using the comparative analysis menu:
$ cosmosid comparative analyses --help
usage: cosmosid comparative analyses [-h] [-f {csv,json,table,value,yaml}] [-c COLUMN] [--quote {all,minimal,none,nonnumeric}] [--noindent]
[--max-width <integer>] [--fit-width] [--print-empty] [--sort-column SORT_COLUMN] [--sort-ascending | --sort-descending]
[--comparative-id COMPARATIVE_ID]
List of all comparative analyses outside comparatives (if there are no any comparative ids)
optional arguments:
-h, --help show this help message and exit
--comparative-id COMPARATIVE_ID
Comparatives' ids
output formatters:
output formatter options
-f {csv,json,table,value,yaml}, --format {csv,json,table,value,yaml}
the output format, defaults to table
-c COLUMN, --column COLUMN
specify the column(s) to include, can be repeated to show multiple columns
--sort-column SORT_COLUMN
specify the column(s) to sort the data (columns specified first have a priority, non-existing columns are ignored), can be repeated
--sort-ascending sort the column(s) in ascending order
--sort-descending sort the column(s) in descending order
CSV Formatter:
--quote {all,minimal,none,nonnumeric}
when to include quotes, defaults to nonnumeric
json formatter:
--noindent whether to disable indenting the JSON
table formatter:
--max-width <integer>
Maximum display width, <1 to disable. You can also use the CLIFF_MAX_TERM_WIDTH environment variable, but the parameter takes precedence.
--fit-width Fit the table to the display width. Implied if --max-width greater than 0. Set the environment variable CLIFF_FIT_WIDTH=1 to always enable
--print-empty Print empty table if there is no data to show.
Example: print list of child comparatives generated under a parent comparative using metadata & cohorts menu
$ cosmosid comparative analyses --comparative-id=<comparative_id>
Export comparative analyses without log scale
$ cosmosid comparative analyses export --help
usage: cosmosid comparative analyses export [-h] --id ID [--tax-level {kingdom,order,phylum,class,family,genus,species,strain}] [--log-scale]
[--concurrent-downloads CONCURRENT_DOWNLOADS] [--dir DIR]
Download results of comparative analyses
optional arguments:
-h, --help show this help message and exit
--id ID IDs of comparative analyses
--tax-level {kingdom,order,phylum,class,family,genus,species,strain}
Taxonomy
--log-scale Includes results with logscale
--concurrent-downloads CONCURRENT_DOWNLOADS
Limit concurrent files downloads
--dir DIR, -d DIR
Output directory for a file. Default: is current directory.
Example export comparative analyses with specified taxonomy level ('species' by default):
$ cosmosid comparative analyses export --id=<analysis_id> --tax-level=class --tax-level=genus