forked from igvteam/igv.js
-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Support browsing past the ends of chromosomes if soft-clips is enable…
…d. See igvteam/igv-reports#66
- Loading branch information
Showing
8 changed files
with
123 additions
and
37 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,51 @@ | ||
<!DOCTYPE html> | ||
<html lang="en"> | ||
<head> | ||
<meta charset="utf-8"> | ||
<meta http-equiv="X-UA-Compatible" content="IE=edge"> | ||
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1, user-scalable=no"> | ||
<meta name="description" content=""> | ||
<meta name="author" content=""> | ||
<link rel="shortcut icon" href="https://igv.org/web/https://igv.org/web/img/favicon.ico"> | ||
|
||
<title>igv.js</title> | ||
</head> | ||
|
||
<body> | ||
|
||
<div id="igvDiv" style="padding-top: 10px;padding-bottom: 10px; border:1px solid lightgray"></div> | ||
|
||
<script type="module"> | ||
|
||
import igv from "../../js/index.js"; | ||
|
||
var options = | ||
{ | ||
genome: "hg19", | ||
locus: "chr1:1-100", | ||
tracks: [ | ||
{ | ||
type: "alignment", | ||
format: "bam", | ||
url: "../../test/data/bam/overhanging_softclip.bam", | ||
indexURL: "../../test/data/bam/overhanging_softclip.bam.bai", | ||
showSoftClips: true, | ||
showMismatches: false | ||
} | ||
] | ||
|
||
}; | ||
|
||
var igvDiv = document.getElementById("igvDiv"); | ||
|
||
igv.createBrowser(igvDiv, options) | ||
.then(function (browser) { | ||
console.log("Created IGV browser"); | ||
}) | ||
|
||
|
||
</script> | ||
|
||
</body> | ||
|
||
</html> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Binary file not shown.
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
@HD VN:1.0 SO:unsorted | ||
@SQ SN:chr1 LN:247249719 AS:hg18 M5:9ebc6df9496613f373e73396d5b3b6b6 | ||
1487_1859_1707 89 chr1 1 26 14S24M * 0 0 ATAGCAATATGCAAGCCACTACACTACACTACAATTAT *88)%';9%%2795798/5<IIIIIIIIIIIHEIIIII NH:i:0 RG:Z:20100713212612939 CS:Z:T33303011321113211132110320131233033233003320201110 CQ:Z:>>@BB=)@@>=:AAA?:>-0&*/+-)1',%*0,'%%4%&)+81%)%*(4. SM:i:32 CM:i:4 |