This is a fork of Paulo Gaspar's mRNA-Optimiser. The purpose of this fork is to enable repeatable results by adding an option of providing a seed for random number generation.

How to compile

First, clone and cd into the repo.

git clone https://github.com/joaks1/mRNA-Optimiser.git
cd mRNA-Optimiser

You can use conda to create an environment with Java (you can skip these steps if you want to use your own installation of Java.

conda env create -f environment.yml
conda activate mrna-optimiser

Lastly, simply run the build script

./build.sh

Now, you should be able to run mRNAOptimiser.jar using -s to specify a seed to get identical results repeatedly

java -jar mRNAOptimiser.jar -i 10 -s 3741515489481741212 GUCACGUACUGACGUACUGCAGUC

mRNA-Optimiser

Console application to redesign mRNA nucleotide sequences (given as text strings) to enhance its secondary structure in terms of minimum free energy

Usage: mRNAoptimizer [*options*] nucleotide_sequence

Example usages:

    **mRNAoptimizer** GUCACGUACUGACGUACUGCAGUCA
    **mRNAoptimizer** -f sequence_file.txt
    **mRNAoptimizer** -f sequence_file.txt -b 100 -e 300 -o output.txt

Options:

• -f inputFile Give input sequence as a file.

• -o outputFile Output results to file (Default = standard output).

• -b index Index of the first nucleotide of the start codon (default=1)

• -e index Index of the last nucleotide of the stop codon (default = sequence size)

• -d type Optimization type: 0 to maximize MFE (default) / 1 to minimize MFE

• -t maxTime Maximum optimization time, in minutes (default = no limit).

• -i iterations Number of iterations the algorithm runs. The more iterations the longer it will take, but results will usually be better (default = 4000)

• -c codingTable Genetic Code Table to use(default=1) according to this list: http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi

• -q Don't output anything else than the resulting sequence.

• -g Maintain the same GC content as the original sequence. With this option, the MFE optimization won't be as expressive.

• -s seed Seed for random numbers.