README_rename_reads.md

Manual for the rename_reads module

Notes

• ⚠️ All reads in the forward and reverse reads files must be in pair and their orders in the two files must be the same.

• The sizes of the output files might be slightly smaller than the input files, which might due to the shorter length of read names in the output files.

  You can use wc -l input_R1.fasta and wc -l output_R1.fasta to get the number of lines in the input and output files and see if the numbers are the same.
  You can also use head R1.fasta or tail R1.fasta to print on the screen the first/last few lines of a file.

Example commands

• In fasta format

  MarkerMAG rename_reads -r1 R1.fasta -r2 R2.fasta -p soil -t 2
  

• In fastq format

  MarkerMAG rename_reads -r1 R1.fastq -r2 R2.fastq -p soil -fq -t 2
  

Format of renamed reads

• [prefix]_R1.fasta

  >[prefix]_1.1
  ATGCATGCATGCATGCATGC
  >[prefix]_2.1
  ATGCATGCATGCATGCATGC
  ...
  

• [prefix]_R2.fasta

  >[prefix]_1.2
  ATGCATGCATGCATGCATGC
  >[prefix]_2.2
  ATGCATGCATGCATGCATGC
  ...